Continuous Perfusion of Mammalian Cells Embedded in Agarose Gel Threads Exp Cell Res

Highlights

  • •

    CircRNA can migrate above or below its corresponding linear RNA in native agarose gels

  • •

    Gel system, sample buffer EDTA, and detection dye affect circRNA migration

  • •

    Orthogonal methods with northern and HPLC confirm circRNA identity

Summary

Circular RNAs are garnering increasing interest as potential regulatory RNAs and a format for gene expression. The characterization of circular RNA using analytical techniques commonly employed in the literature, such as gel electrophoresis, can, under differing conditions, yield different results when attempting to distinguish circular RNA from linear RNA of similar molecular weights. Here, we describe circular RNA migration in different conditions, analyzed by gel electrophoresis and high-performance liquid chromatography (HPLC). We characterize key parameters that affect the migration pattern of circular RNA in gel electrophoresis systems, which include gel type, electrophoresis time, sample buffer composition, and voltage. Finally, we demonstrate the utility of orthogonal analytical tests for circular RNA that take advantage of its covalently closed structure to further distinguish circular RNA from linear RNA following in vitro synthesis.

Keywords

  • circular RNA
  • circRNA
  • electrophoresis
  • E-gel
  • RNase R
  • RNase H

Introduction

Circular RNAs (circRNAs) are covalently closed, single-stranded RNA species that naturally arise from back splicing. CircRNAs are prevalent in eukaryotic transcriptomes and have recently gained widespread interest for their roles in disease regulation and as therapeutic modalities for gene delivery and protein production (

;

,

). Methods to produce synthetic circRNA from in vitro transcription reactions using enzyme-mediated ligation or permuted autocatalytic introns have been described (

;

,

). The resulting circRNA can be identified using a range of orthogonal techniques including gel electrophoresis, RNase R digestion, oligonucleotide-guided RNase H digestion, single-hit hydrolysis, and high-performance liquid chromatography (HPLC).

Wesselhoeft et al. and Chen et al. previously reached different conclusions on the immunogenicity of synthetic circRNAs relative to linear RNAs (

;

,

). During efforts to resolve these conflicting conclusions, we identified differences in circRNA migration behavior dependent on the agarose gel systems used. Wesselhoeft et al. reported on properties of synthetic circRNAs generated using in vitro transcription reactions (

,

). The authors used gel electrophoresis and HPLC methodologies to discriminate circular species and nicked linear species of the same sequence and molecular weight. As we further explored the properties of circRNA, we identified additional analytical conditions that can influence the outcomes of such experiments. If unrecognized, investigators using certain types of electrophoresis methods could potentially mischaracterize the identity of the RNA species in question. We present our findings here to raise awareness of this issue within the circRNA community and to describe additional tools for circRNA identification using multiple orthogonal methods.

Results

CircRNA migrates according to molecular weight in some, but not all, agarose electrophoresis conditions

Agarose gel electrophoresis is a simple and widely used method to study the size of RNA. RNA is negatively charged and migrates toward the anode in an electric field. When applied across an agarose gel, the gel acts as a sieve to impede RNA migration based on its mass and shape. As mass is approximately related to nucleic acid length, longer RNA strands of the same structure migrate more slowly than shorter RNA. Secondary structures within RNA can influence its migration through these gels, and therefore, denaturing agents are often used. We synthesized circRNA using in vitro transcription and sought to identify different RNA species using northern blot analysis. We designed probes to identify pre-circularization precursor RNA, circRNA, and excised intron byproducts as shown in Figure 1A. We also designed a linear control that lacks portions of the introns needed for circularization. Standard agarose gel electrophoresis shows the precursor RNA running as expected near the 2,000-nt marker, which is degraded upon RNase R digestion (Figure 1B). A faster-migrating band between 1,000 nt and 1,500 nt resists RNase R digestion, indicating it is likely circRNA. This is confirmed by northern blot analysis, showing no signal with excised probes (probes 1 and 5) but a positive signal with the splice junction probe (probe 6).

Figure thumbnail gr1

Figure 1 CircRNA migration using standard agarose systems

Show full caption

(A) Schematic and expected sizes of precursor linear RNA, linear control RNA, circRNA, and excised introns. Linear control RNA is splicing incompetent as it lacks the full upstream and downstream introns necessary for splicing but retains remnant introns expected after splicing. Probes targeting the indicated segments of the RNA are numbered 1–6 in the indicated colors.

(B) Northern blot correctly identifies circRNA using standard agarose electrophoresis. CircRNA and linear control RNA were treated with RNase R for 15 min and 60 min. Samples were incubated in NorthernMax-Gly Sample Loading Dye containing glyoxal, glycerol, and DMSO and run at 50V for 80 min at room temperature using traditional agarose gels cast in our lab. Size markers are indicated on the left; biotinylated probes used for each northern blot are indicated on the left and correspond with (A). RNA species are labeled on the right. Gel and northern blot images were cropped above the 2,000-nt marker for clarity.

Wesselhoeft et al. (

,

) reported the use of E-Gel EX electrophoresis systems (prepackaged native agarose gel, Thermo Fisher) to distinguish circRNAs from other RNA species. They prepared samples in a denaturing buffer that was run into the native gel and showed that the circRNA migrates more slowly (i.e., appearing larger) than its true size under these conditions. The circRNA migrated more slowly than the linear precursor of larger molecular weight, allowing the authors to distinguish intact circRNA from both larger precursor RNA and equal-weight nicked circRNA (Figure 2A, left). The RNA migration in this system is therefore different for circRNA and linear RNA, likely reflecting the differences in their topology. This unexpected observation was dependent on the use of E-Gel EX gels and is a useful property that was different from published reports of circRNA electrophoresis patterns performed in different conditions (

;

,

).

Figure thumbnail gr2

Figure 2 CircRNA apparent size changes with electrophoresis conditions

Show full caption

(A) CircRNA migration on E-Gel EX systems using sample buffer containing formamide only. CircRNA migrates slower than precursor RNA when run on E-Gel EX 2% gels using program "EX1-2%" for 10 min at room temperature. Extending electrophoresis duration to 18 min enhances separation of circular and linear splicing reaction species and maintains the same migration pattern as 10 min. Gel artifacts are visible as bubbles in the gel, increasing in severity with longer electrophoresis. RNA species are labeled on the right. L, ladder; IVT, in vitro transcription reaction; Circ, circularized RNA; Lin, linear RNA control.

(B) CircRNA migration can overlap precursor RNA when using commercially available sample buffer. CircRNA was denatured in GLB II sample buffer and electrophoresis performed as in (A). The circRNA band is clearly separated from the precursor band after 13 min of electrophoresis but overlaps the precursor after 18 min. The mass of RNA loaded into the gel does not affect this migration pattern. L, ladder; R, circularized RNA not treated with RNase R.

(C) Changes in circRNA apparent size is specific to the E-Gel EX system. Top panels: E-Gel EX; bottom panels: non-EX E-Gel. RNase R-treated circularized RNA samples were denatured in GLB II buffer and subjected to the same electrophoresis conditions as in (A). Time points are indicated above gels. CircRNA migration relative to the 2,000-nt RNA marker is shown by colored arrowheads (red: above 2,000-nt marker, yellow: with 2,000-nt marker, green: below 2,000-nt marker).

We sought to further define parameters of the E-Gel EX system that allow for this distinct migration behavior of circRNA. We used a commercially available sample buffer containing formamide as the denaturing agent (GLBII, Thermo Fisher), similar to the methods in Wesselhoeft et al., with the exception that it also contains EDTA, SDS, bromophenol blue, and xylene cyanol. When circularized RNA (without RNaseR digestion) was run on E-Gel EX 2% gels for 13 min using the program "EX1-2%" at ambient temperature, three predominant bands appeared: an intense upper band migrating equivalently to a 2,500-nt linear RNA (circular), a faint middle band migrating slightly slower than a 2,000-nt linear equivalent (precursor), and a clear lower band migrating just faster than a 1,500-nt linear equivalent (nicked) (Figure 2B, left). These results reproduced the findings of

. When the same gel was run for an additional 5 min (18 min total), the upper band advanced from 2,500 nt to 2,000 nt, overlapping the middle band. Thus, extending the run time potentially caused the circRNA to migrate at the same position as the linear precursor (Figure 2B, right). The lower nicked RNA band was not affected by this additional time, as it migrated unchanged just below 1,500 nt. The amount of RNA in the well did not influence the change in apparent size, as the same migration shift was observed with different loading amounts.

A detailed analysis of purified circRNA using the E-Gel EX system with GLBII buffer documents this migration behavior over time (Figure 2C, upper panel). We used an RNase R-treated circRNA preparation that runs as two bands, the upper band corresponding to intact circle and lower band corresponding to a minor nicked product, prepared in GLBII buffer. CircRNA migrated as a dominant upper band at the 2,500-nt marker at 10 min, migrated toward 2,000 nt at 22 min (indicated by red arrowheads), comigrated with the 2,000-nt marker at 25 min and 28 min (yellow arrowheads), and migrated below the 2,000-nt markers after 31 min (green arrowheads). This was not observed when using a sample buffer containing formamide only (Figure 2A, right), indicating that sample buffer preparation greatly influences the migration behavior of circRNA in the E-Gel EX system. This difference was also not observed using a non-EX E-Gel, where the apparent size of circRNA migrated according to its molecular weight at just below 1,500 nt throughout the electrophoresis time course (Figure 2C, lower panel).

To explore the changes in circRNA migration pattern seen specifically with GLBII buffer on E-Gel EX systems, we tested each component of GLBII buffer separately. GLBII buffer (2× stock) contains 95% formamide, 18 mM EDTA, 0.025% SDS, 0.025% bromophenol blue, and 0.025% xylene cyanol. Circularized RNA with or without RNase R digestion was denatured 1:1 in formamide alone or with each component at the concentration in GLBII buffer (Figure 3A). The addition of EDTA caused circRNA to migrate faster compared to formamide or formamide with SDS. EDTA also prevented nicking of circRNA (shown by the faint nicked band) and degradation of RNA (shown by smearing below nicked RNA). This is also apparent on non-EX E-Gels (Figure 3A, bottom), where the absence of EDTA favored the accumulation of nicked RNA species when run for 31 min using program "EX1-2%." Also notable in the non-EX gel is the reversed migration patterns of precursor and circRNA, similar to that observed in non-E-Gel agarose systems.

Figure thumbnail gr3

Figure 3 Sample buffer conditions affect migration pattern of circRNA

Show full caption

(A) EDTA decreases apparent size of circRNA and protects circRNA from nicking and degradation. Circularized RNA (treated with and without RNase R) were denatured in sample buffer containing reagents depicted in the figure and run on either E-Gel EX 2% or non-EX E-Gel 2% precast gels for the indicated time using program "EX1-2%" at room temperature. Concentrations of each reagent prior to 1:1 mixing with RNA is as follows: formamide, 95%; EDTA, 18 mM; SDS, 0.025%; bromophenol blue (BB) and xylene cyanol (XC), 0.025% each. Ladder is shown on the left and was prepared in formamide-only sample buffer. RNA species are labeled on the right.

(B) Buffer carryover in circRNA preparations alters circRNA mobility during electrophoresis in the presence of 50 mM EDTA. The distance between circRNA and linear precursor RNA narrows when 1× T4 RNA ligase I buffer and EDTA are added to samples prior to gel loading but not when buffer alone is added (red dotted line). A proportionally smaller shift toward lower molecular weight is visible for precursor RNA. RNA species are labeled on the right.

(C) Buffer carryover in circRNA preparations dramatically alters precursor RNA mobility during size-exclusion chromatography through the emergence of a new peak but minimally affects circRNA mobility. 1× T4 RNA ligase buffer I was added to samples prior to HPLC sample injection with or without 50 mM EDTA. Note the lack of introns in all IVT conditions, indicating that splicing is not occurring.

(D) Lower voltage causes overlap of circRNA with precursor linear RNA. RNA was prepared in sample buffers as in (A), loaded onto two E-Gel EX 2% gels, and subjected to either a high-voltage program "EX1-2%" (upper) ora low-voltage program "SizeSelect2%" (lower) at room temperature for the time periods indicated on the left. These times are comparable with each voltage setting based on the distance of xylene cyanol migration depicted as the white areas on the right side of each gel. Ladder is shown on the left and was prepared in formamide-only sample buffer. RNA species are labeled on the right.

(E) Denaturation in the presence of SYBR-GOLD I in the sample buffer abrogates the aberrant migration pattern of circRNA seen on E-Gel EX systems. Ladder and RNase R-treated circRNA were denatured in the sample buffers described on top at a 1:1 ratio of sample to buffer, loaded onto E-Gel EX 2% gels, and run for 10 min (top panel) or 18 min (bottom panel) at room temperature using program "EX1-2%." RNA species are labeled on the right. Sample buffer conditions prior to 1:1 dilution: Form only, 95% formamide; Form +SyGOLD, 95% formamide with 0.025% SYBR-GOLD I; Form +EtBr, 95% formamide with 0.025% ethidium bromide; GLB II, 95% formamide with 18 mM EDTA and 0.025% each of SDS, bromophenol blue, and xylene cyanol; RLD, 95% formamide with 0.5 mM EDTA and 0.025% each of SDS, ethidium bromide, bromophenol blue, and xylene cyanol.

Divalent salts, reducing agents, and other buffer components in circRNA preparations may be present because of their use in transcription and circularization reactions. Depending on conditions used, buffer components can be carried over through transcription reaction cleanup measures, including buffer exchange filters and silica columns, which often reduce but do not eliminate these buffer components. We found that the addition of buffer containing monovalent and divalent salts did not change circRNA migration during electrophoresis; however, the addition of EDTA resulted in a shift toward smaller molecular weight for both precursor and circRNA species (Figure 3B). This shift was proportionally more apparent for circRNA, resulting in the near overlap of circular and precursor RNA bands. The effects of EDTA on migration pattern were not observed when using size-exclusion chromatography (Figure 3C), indicating specificity for electrophoresis-based systems.

RNA migration distance in electrophoresis systems is dependent on voltage, and we sought to determine whether voltage influenced the circRNA migration pattern seen on E-Gel EX systems. Each E-Gel cassette is self-enclosed with prepackaged dye and running buffer, and the E-Gel device uses proprietary preset voltages that cannot be modified. We therefore used a different preset program, "SizeSelect2%," that uses a lower voltage setting based on the electrophoresis time needed to migrate visualization dyes across the cassette. We observed that an electrophoresis time of 25 min using program "EX1-2%" and 32 min using program "SizeSelect2%" produced equivalent migration of xylene cyanol on the gel (Figure 3D, white area in last two lanes equivalent to 1,000 nt). CircRNA migration shifted from 2,000 nt in the high-voltage "EX1-2%" (upper gel) to below 2,000 nt in the low-voltage "SizeSelect2%" program (lower gel), indicating that lower voltages favor circRNA migration closer to its expected molecular weight. The precursor band is not distinguishable from circRNA in the lower voltage setting, likely due to overlap with the abundant circRNA species. Linear nicked RNA migrates consistently between the two voltage settings at just below 1,500 nt. The effects of EDTA are also observed with the lower voltage setting.

EX-based E-Gels use SYBR-GOLD II as a detection dye, whereas standard E-Gels use SYBR-Safe. We therefore tested whether interactions between circRNA and SYBR-GOLD II could cause the aberrant migration behavior of circRNA. As SYBR-GOLD II is proprietary to EX E-Gels and not sold individually, we tested SYBR-GOLD I as it was commercially available with the assumption that it has similar properties to SYBR-GOLD II. We added SYBR-GOLD I to the formamide sample buffer prior to electrophoresis and observed that it nearly abrogated the aberrant migration behavior of circRNA on EX gels, with circRNA migrating similarly to non-EX gels at just above 1,500 nt (Figure 3E). Addition of ethidium bromide to the formamide-only sample buffer had no appreciable effect on circRNA migration. We also tested two commercially available formamide-based sample buffers: GLB II (used in previous figures) and RLD (similar to GLB II but contains 0.5 mM EDTA and 0.025% ethidium bromide, Thermo Fisher). GLB II sped the migration of circRNA as seen in previous figures (circRNA runs slightly below 2,500 nt), likely due to the presence of 18 mM EDTA, and RLD caused a more significant shift with circRNA migrating at 2,000 nt. This shift with RLD was unexpected as it contains lower EDTA than GLB II; however, we cannot exclude the possibility of a combinatorial effect of each component in the RLD sample buffer. A summary of the effects on sample buffer components on circRNA migration is provided in Table 1.

Table 1 Effects of sample buffer reagents on circRNA migration in E-Gel EX systems

Reagent Effects on circRNA migration
Ethylenediaminetetraacetic acid (EDTA) Shifts migration closer to expected molecular weight; chelates residual divalent cations that may reduce RNA degradation during analysis
Sodium dodecyl sulfate (SDS) No effect
Bromophenol blue No effect
Xylene cyanol No effect
Sybr-GOLD Shifts migration closer to molecular weight
Ethidium bromide No effect alone; shifts migration closer to molecular weight in RLD buffer

Electrophoresis generates heat in the gel and running buffer that can affect RNA stability and therefore its migration pattern. We found no significant differences in circRNA migration when running EX E-Gels in a cold room set at 4°C for 13 min. This is likely due to the heat generated in the cassettes that offsets the ambient cold air (data not shown). We have noted lot-to-lot variability in EX E-Gels that can affect circRNA migration speed but not linear RNA migration speed relative to a linear RNA ladder. CircRNA splicing reactions run on two different lots of E-Gel EX 2% gels showed consistent linear but different circRNA migration patterns, with a 1,400-nt circRNA migrating only somewhat slower than the higher-molecular-weight linear precursor RNA on gel lot 1 (at ∼2,400 nt) and much slower than precursor RNA on gel lot 2 (at ∼3,000 nt) (Figure S1). A trans-spliced product composed of two covalently linked linear molecules ran at around 3,600 nt in both gel lots. We have also observed that this reduced circRNA migration through agarose is affected by size. The smaller circRNA (1,100 nt) migrated faster than its linear precursor in gel lot 1 and just barely slower than its linear precursor in gel lot 2, suggesting that slower circRNA migration in these gel conditions is enhanced at larger circRNA sizes.

These results demonstrate that circRNA band migration is dependent on multiple factors in the E-Gel EX system including electrophoresis time, voltage settings, sample buffer composition, gel batch, RNA size, and likely additional factors not analyzed here. Users wishing to exploit the slower migration of circRNA on E-Gel EX gels may benefit from the analysis here to optimize circRNA separation from nicked RNA of identical molecular weight. The potential for band pattern inversion when working with smaller circRNAs should also be monitored. A summary table comparing differences between gel types is provided in Table 2.

Table 2 Comparison of agarose-based electrophoresis systems on circRNA migration

Agarose Gel Advantages Disadvantages
E-Gel EX Distinguish between circRNA and linear RNA of equivalent lengths; fast/convenient Expensive; may show variability between lots (see Figure S1)
E-Gel (non-EX) Fast/convenient CircRNA overlaps with linear RNA of equivalent lengths
Self-cast agarose gels Migrates near expected size; ability to control running buffer conditions and voltage settings; optimal for northern blots Time consuming; circRNA overlaps with linear RNA of equivalent lengths

Orthogonal methods to further confirm circRNA identity

To further confirm the identity of circRNA, we recommend using orthogonal methods. Here, we performed several additional analyses to verify the identity of the major product of these reactions as circular. The first method is northern blot, which is sequence specific and can be used to detect the presence of intron fragments that are present in precursor RNA and absent in circular/nicked RNA or exon fragments that are present in all (

;

;

). Northern blot analysis on two electrophoresis conditions that gave contrasting migration patterns for circRNA on E-Gel EX correctly identified circRNA migrating above its precursor RNA in GLB II buffer and higher voltage and below its precursor RNA using RLD buffer and lower voltage settings (Figure 4A). In our experience, northern blot resolution is diminished when using E-Gels (both EX and non-EX) and formamide, and this type of analysis has the best results with self-cast agarose gels run at lower voltages using glyoxal as a denaturing agent.

Figure thumbnail gr4

Figure 4 Orthogonal methods to confirm circRNA identity

Show full caption

(A) Northern blot analysis of E-Gel EX system. Samples were denatured 1:1 in RLD (2× RNA Loading Dye, Thermo Fisher) or GLB II (Gel Loading Buffer II, Thermo Fisher), run on E-Gel EX 2% gels, and subjected to different voltage programs indicated at the top. Agarose image is shown in top panel; northern blots are shown in lower panels. The probes are depicted on the right of each blot and correspond to the schematic shown in Figure 1A.

(B) Size-exclusion chromatography of circRNA. CircRNA elutes off the column with a slightly smaller molecular weight than predicated. Larger and smaller linear RNA species are on the left and right, respectively. Nicked circRNA is visible as a minor peak at 9.75 min, directly before the major circRNA peak. RNase R digestion identifies circRNA as a single enriched peak.

(C) RNA circularity can be validated by nicking the RNA randomly using heat and divalent cations such as Mg2+. 1× T4 RNA ligase I buffer, containing magnesium, was added to RNA sample, and RNA in buffer was heated at 70°C for the indicated duration. IVT material, which is mostly linear, produces a smear of variable molecular weight species extending from the full-length band when randomly nicked. Circularization reaction material digested with RNase R, which is mostly circular, enriches the lower "nicked" linear RNA band before producing a smear that extends from this band when randomly nicked. No smear extends from the circRNA band. Note that the top and bottom bands are of equal molecular weight.

(D) Samples in (C) were analyzed by HPLC. Degradation of precursor RNA by heat and magnesium shows typical tailing of RNA toward lower molecular weights, consistent with the smear seen by gel electrophoresis. In contrast, degradation of circRNA results in enrichment of a new peak corresponding to nicked RNA of equivalent molecular weight, which is followed by tailing as degradation continues. Unlike gel electrophoresis wherein intact circRNA appears at much higher molecular weight than nicked RNA, circRNA appears smaller than its nicked counterpart when analyzed using HPLC.

(E) Site-specific degradation using oligonucleotide-guided RNase H digestion is another method for validating RNA circularity. Site-specific degradation will yield two linear products when cutting linear RNA species and one linear product when cutting circRNA. Predicted degradation products for precursor RNA in this experiment are 1,371 nt and 399 nt in length, visible as the two major product bands in lane 4. Degraded circRNA yields a single product at 1,455 nt. Several off-target digestion products are visible as fainter bands.

(F) Samples in (E) were analyzed by HPLC. Degradation of precursor RNA using RNase H yields two smaller fragments. Degradation of circRNA using RNase H results in enrichment of a single fragment corresponding to nicked RNA of equivalent molecular weight, similar to the product generated by heat/magnesium nicking except that the starts and ends of the nicked molecules are expected to be homogeneous.

As previously described, size-exclusion chromatography can also be employed to identify circRNA without electrophoresis (

). Absorbance traces showed circRNA appearing smaller than its precursor RNA, similar to non-EX agarose gel electrophoresis (Figure 4B). In contrast to both non-EX and EX agarose gel electrophoresis methods, circRNA also appeared smaller than nicked RNA of equivalent molecular weight as previously described (

). RNase R digestion of splicing reactions confirmed the major circRNA peak that corresponds to the major surviving gel band. Addition of buffer components to samples prior to HPLC loading altered precursor RNA elution times and produced a second major peak (Figure 3C, middle left tracing, 10 m) eluting earlier than a putative circRNA peak (Figure 3C, middle right tracing, 10.4 m) without altering free intron composition, suggesting that salt presence during sample injection may stabilize strong intron secondary structures and that dilution of sample in running buffer is not enough to compensate for this effect. CircRNA elution times and peaks were largely unaffected, possibly because they do not contain intron structures, while free introns showed a minor shift toward a larger demonstrated molecular weight. Unlike agarose gel electrophoresis, EDTA addition did not substantially change chromatograms. Thus, care must be taken when preparing structured RNAs for native SEC-HPLC and interpreting resulting chromatograms.

Several secondary validation methods can be combined with electrophoresis and chromatography analytical steps to confirm circularity. Two exemplary methods both employ the concept of controlled degradation to introduce single cuts into the RNA backbone (nicking). CircRNA can be nicked non-specifically by applying magnesium and heat for approximate single-hit kinetics, or specifically using oligonucleotide-guided RNase H degradation. Nicking a linear molecule results in two products, while nicking a circRNA results in one product of equal molecular weight. Using a linear precursor RNA in vitro transcription reaction input, we saw progressive nicking of a single major band into a smear of degradation products extending from the intact band, consistent with random backbone cuts that produce fragments of variable lengths (Figure 4C). Using a majority circRNA input, we observed depletion of the top circRNA band and enrichment of the bottom nicked circle band as degradation progressed. Notably, a smear extended from the bottom band but not from the top band, a phenomenon that confirms the distinct identity of these two species. Analysis by HPLC reflected our gel electrophoresis observations, with a linear input progressively degrading into a smear of lower-molecular-weight products while a majority of circular input enriches for the apparently higher-molecular-weight nicked RNA peak prior to tailing off into lower-molecular-weight products through secondary nicking events (Figure 4D).

Targeted RNA degradation using oligonucleotide-guided RNase H digestion yields a different banding pattern because of the non-random nature of the degradation site. Because the digestion site is not random as it is with divalent cation-mediated hydrolysis, two distinct bands are expected for linear RNA digestion instead of a smear of random-length products. One distinct band is expected for a nicked circRNA, as a backbone nick anywhere within a circle will always yield a single product of uniform molecular weight regardless of whether it is targeted or random. Enzyme-negative samples showed the expected banding pattern for input materials, while RNase H-treated samples yielded the predicted banding patterns for both linear and circRNA (Figure 4E). These patterns were clearly visible by HPLC, with an apparently higher-molecular-weight nicked peak emerging after circRNA digestion as expected (Figure 4F). We note that the digestion reaction was not complete, and some undigested precursor and circRNA material survived the digestion intact. Furthermore, minority secondary digestion products were visible in both samples. Oligonucleotide design and reaction optimization are important factors to consider for targeted RNase H-mediated digestion to ensure interpretable results.

Discussion

Future verification of circRNA production and purification

The work developed here describes several simple steps to facilitate the identification of circRNA versus linear RNA species. First, investigators should be aware of the variation in circRNA migration pattern seen when using the E-Gel EX system compared with standard agarose systems. Second, we encourage investigators to show molecular weight markers so that the electrophoretic migration patterns can be assessed in the context of known materials. Third, investigators can apply orthogonal detection methods such as northern blot analysis, nicking assays, RNase R digestion, and particularly HPLC to further verify the RNA species. Some of these strategies have helped to distinguish endogenous circularized exons from host mRNA transcripts (

Memczak et al., 2013

  • Memczak S.
  • Jens M.
  • Elefsinioti A.
  • Torti F.
  • Krueger J.
  • Rybak A.
  • Maier L.
  • Mackowiak S.D.
  • Gregersen L.H.
  • Munschauer M.
  • et al.

Circular RNAs are a large class of animal RNAs with regulatory potency.

;

), while others may be most applicable to the study of synthetic circRNAs (

,

). These complementary approaches should facilitate identification of circRNAs after in vitro synthesis.

Limitations of the study

This paper addresses the differences in circRNA migration behavior observed when comparing traditional agarose systems with the E-Gel EX system. The first limitation of this study includes the proprietary nature of the E-Gel EX ecosystem, where conditions such as running buffer, detection dye, and precise control of voltage settings are fixed. We addressed this limitation by modifying variables, such as the sample buffer, using different preset voltage programs and using non-EX gel cassettes. We recognize that there are other conditions not tested in this study that can influence the migration behavior of circRNA. Second, we only tested agarose-based gel electrophoresis systems, focusing on the observations seen in E-Gel EX systems. It should be noted that this migration pattern of circRNA migrating higher than its molecular weight has been observed in denaturing PAGE gel systems using small circRNAs (<1,000 nt); however, the buffer conditions were not specified (

,

). We tested circRNA sizes down to 1,100 nt in length (Figure S1) and up to 2,250 nt (data not shown) and found consistent migration patterns; however, we cannot exclude the possibility that much larger circRNAs may behave differently. Third, whether different RNA modifications affect this migration behavior is unclear, but we have found consistent migration behavior with N6-methyladenosine modification up to a level of ∼10% of adenosines (

;

; unpublished data). Fourth, this study does not address the immunogenicity of circRNAs. Our two groups reported different strategies to overcome circRNA immunogenicity. Chen et al. reported that transfection of purified, in vitro generated circRNA into mammalian cells led to potent induction of innate immunity related to intron identity (

). In 2019, Chen et al. described that circRNA immunogenicity can be suppressed by N6-methyladenosine modification (

). Wesselhoeft et al. reported purification methods reducing the immunogenicity of circRNAs (

). Recently, Liu et al. reported that circRNAs made by self-splicing intron are immunogenic, but circRNAs made by T4 ligase have decreased immunogenicity (

). These differences remain to be addressed in future studies. Despite these limitations, we present awareness of differing circRNA migration patterns depending on the electrophoresis system used and recommend the RNA community to use orthogonal methods in addition to electrophoretic methods to confirm circRNA identity.

STAR★Methods

Key resources table

Tabled 1

REAGENT or RESOURCE SOURCE IDENTIFIER
Chemicals, peptides, and recombinant proteins
DNase I (RNase-free) New England Biolabs M0303L
RNase R MCLAB RNASR-100
Millennium RNA Markers Thermo Fisher AM7150
Bullseye Agarose MidSci BE-A500
SYBR Safe DNA Gel Stain Thermo Fisher S33102
SYBR GOLD Nucleic Acid Gel Stain Thermo Fisher S11494
BrightStar-Plus Positively Charged Nylon Membrane Thermo Fisher AM10100
RNA Gel Loading Dye (2X) Thermo Fisher R0641
Gel Loading Buffer II Thermo Fisher AM8546G
Ultrapure Formamide Thermo Fisher 15515026
EDTA (0.5M), pH 8.0, RNase-Free Thermo Fisher AM9260G
Ultrapure SDS Solution, 10% Thermo Fisher 15553027
SuperBlock (PBS) Blocking Buffer Thermo Fisher 37515
RiboLock RNase Inhibitor Thermo Fisher EO0381
IRDye 800CW Streptavidin LI-COR 926-32230
RNA ScreenTape Agilent 5067-5576
RNA ScreenTape Sample Buffer Agilent 5067-5577
RNA ScreenTape Ladder Agilent 5067-5578
RNase H New England Biolabs M0297S
T4 RNA Ligase I New England Biolabs M0204S
Critical commercial assays
Platinum SuperFi II PCR Master Mix Thermo Fisher 12368010
NEBuilder HiFi DNA Assembly Master Mix New England Biolabs E2621S
HiScribe T7 High Yield RNA Synthesis Kit New England Biolabs E2040S
Q5 Hot Start High-Fidelity 2x Master Mix New England Biolabs M0494X
DNA Clean & Concentrator-100 Zymo Research D4029
Monarch RNA Cleanup Kit New England Biolabs T2050L
NorthernMax-Gly Kit Thermo Fisher AM1946
Pierce RNA 3′ End Biotinylation Kit Thermo Fisher 20160
iBlot 2 Transfer Stacks, nitrocellulose, mini Thermo Fisher IB23002
E-Gel EX Agarose Gels, 2% Thermo Fisher G401002
E-Gel Agarose Gels with SYBR Safe, 2% Thermo Fisher G521802
Deposited data
Original Image Files This paper Mendeley Data: https://dx.doi.org/10.17632/62bwm34jvr.1
Oligonucleotides
Circular precursor F: taatacgactcactatagggagaccc This paper N/A
Circular precursor R: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT

caggaaacagctatgaccatgattacg

This paper N/A
Linear control F – GLUC: CATGCATGCATGCATGGCCAGTGAATTG

TAATACGACTCACTATAGGGaaaatccgttgaccttaaacgg

This paper N/A
Linear control R – GLUC: aagtccgtagcgtctcg This paper N/A
1-UpExc: ctcccgtcgagtctctgcaccttccgattagttgtaagtcatctattgtt This paper BTA-NB011
2-UpRet: tgggggtggagggacttgaacccacacgaccgtttaaggtcaacggattt This paper BTA-NB013
3-GLUC: tcgagatccgtggtcgcgaagttgctggccacggccacgatgttgaagtc This paper BTA-NB019
4-DownRet: aagtccgtagcgtctcgccggtaacgcataatagccgttttgttttttgt This paper BTA-NB017
5-DownExc: cttactaattactacttcggcttggctcaggattgccttgtctataacta This paper BTA-NB012
6-ANA Splice Junction: cacgaccgtttaaggtcaacggattttaagtccgtagcg

tctcgc

This paper BTA-NB020
RNase H Probe

Wesselhoeft et al., 2019

  • Wesselhoeft R.A.
  • Kowalski P.S.
  • Parker-Hale F.C.
  • Huang Y.
  • Bisaria N.
  • Anderson D.G.

RNA Circularization Diminishes Immunogenicity and Can Extend Translation Duration In Vivo.

N/A
Recombinant DNA
GLuc APIE CVB3 pAC

Wesselhoeft et al., 2019

  • Wesselhoeft R.A.
  • Kowalski P.S.
  • Parker-Hale F.C.
  • Huang Y.
  • Bisaria N.
  • Anderson D.G.

RNA Circularization Diminishes Immunogenicity and Can Extend Translation Duration In Vivo.

N/A
circFOREIGN

Chen et al., 2019

  • Chen Y.G.
  • Chen R.
  • Ahmad S.
  • Verma R.
  • Kasturi S.P.
  • Amaya L.
  • Broughton J.P.
  • Kim J.
  • Cadena C.
  • Pulendran B.
  • et al.

N6-Methyladenosine Modification Controls Circular RNA Immunity.

N/A
pNL1.1.PGK[Nluc/PGK] Promega N1441
Software and algorithms
Bio-Rad Image Lab v5.2 Bio-Rad https://www.bio-rad.com/en-us/product/image-lab-software?ID=KRE6P5E8Z
Li-COR Image Studio Acquisition Software v3.1 Li-COR https://www.licor.com/bio/image-studio/
Li-COR Image Studio Lite Software v5.2 Li-COR https://www.licor.com/bio/image-studio-lite/

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Howard Chang ( [email protected] ).

Materials availability

Plasmids and oligonucleotides generated in this study are available upon request.

Method details

Plasmids, IVT templates, and RNA synthesis

Construction of GLuc APIE CVB3 pAC has been described previously (

) and was used as template for circular precursor and linear control PCRs. RNA was synthesized using in vitro transcription (IVT) kits (HiScribe T7 High Yield RNA Synthesis Kit). IVT templates were PCR amplified (Q5 Hot Start High-Fidelity 2x Master Mix) as described above and silica column purified prior to RNA synthesis (DNA Clean & Concentrator-100), or digested from plasmid and silica column purified (Purelink, ThermoFisher). One microgram of IVT template was used per reaction size, and reactions were incubated for two h at 37°C with shaking at 1000rpm. The IVT template was degraded with DNaseI at two units per ten micrograms of expected RNA yield for 20 min at 37°C with shaking at 1000rpm. RNA was silica column purified prior to further enzymatic reactions, quantified using a Nanodrop One spectrophotometer, and verified using an Agilent TapeStation according to manufacturer's recommendations. In some cases, uncircularized IVT product was subjected to a separate circularization step: T4 RNA ligase I buffer (New England Biolabs) was added to silica column-purified RNA at a final concentration of 1x with GTP to a final concentration of 2mM. Samples were heated at 55°C for 8 m, and then silica column purified.

RNase R digestion

Column purified RNA was digested with RNase R at a concentration of one unit per one microgram of RNA for either 15 or 60 min at 37°C with shaking at 1000rpm. Half the amount of RNase R was added after 7 min of digestion as previously described (

). Samples were silica column purified after RNase R treatment prior to gel analysis.

Traditional agarose electrophoresis

Agarose gels (2%) were prepared by melting two grams of RNase-Free agarose per 100ml of TAE running buffer and poured into casting trays. In the case of Northern blots, agarose gels were prepared using 1x NorthernMax-Gly running buffer, and RNA was denatured in glyoxal containing sample buffer by diluting 1:1 volumetrically, heating to 50°C for 30 min, and chilling on ice for at least three minutes. RNA was loaded into each well and run at 50V at room temperature until the bromophenol blue dye reached the edge of the gel, roughly 80 min. Agarose gels were post-stained with SYBR-Safe (1:10,000 dilution in 1x NorthernMax-Gly buffer) and images were taken using a Bio-Rad Gel Doc XR and Image Lab 5.2 software using the "SYBR-Safe" settings.

E-Gel electrophoresis system

RNA samples and markers were denatured by diluting 1:1 volumetrically with the indicated sample buffers for each figure. In all cases except for Northern blots, the 2x sample buffers contained 95% formamide. For EDTA testing, sample buffers were prepared with 95% formamide and either 18mM or 50mM EDTA (Figures 3B and 3C). For SDS testing, 0.025% SDS was included with 95% formamide. For SYBR-GOLD testing, 0.025% SYBR-GOLD was added to 95% formamide. Commercially available 2x RNA sample buffers were used where indicated (GLB II: Gel Loading Buffer II, ThermoFisher; RLD: RNA Loading Dye 2X, ThermoFisher). For carryover buffer testing, 1x RNA ligase buffer (New England Biolabs) was added to the sample prior to heating. In all cases, samples were volumetrically diluted 1:1 to a final volume of 20ul/well, heated to 70°C for at least 2 min, and chilled on ice for at least three minutes. Samples were loaded onto either 2% E-Gel EX Agarose Gels with SYBR-GOLD II or 2% E-Gel Agarose Gels with SYBR Safe and run on the E-Gel Powersnap Electrophoresis System using programs "EX1-2%" or "SizeSelect2%" for the times indicated in the figures at room temperature. Images were taken with a Bio-Rad Gel Doc XR and Image Lab 5.2 software using the "SYBR-Safe" settings. For Northern analysis, the E-Gel cassettes were opened and carefully placed onto Brightstar nylon membranes.

Northern blot

Northern blot analysis was carried out following the NorthernMax-Gly Kit (ThermoFisher). Briefly, RNA was prepared and separated on either standard agarose gels or E-Gels as described above. For size identification, biotinylated markers were made using the Pierce RNA 3′ End Biotinylation Kit and subsequently column purified. After gel electrophoresis, RNA was transferred to a Brightstar-Plus nylon membrane using the iBlot2 Dry Blotting System with the following settings: 20V for 2 min, 23V for 2 min, 25V for 3 min. In cases of transferring E-Gels, the E-Gel cassettes were opened and gels transferred onto membranes using the same settings. Membranes were gently rinsed with water and UV crosslinked with a Stratagene Stratalinker 2400 using the "Auto Crosslink" setting. Hybridization and washing steps were performed at 42°C following the NorthernMax-Gly Kit protocol. Hybridization probe sequences are provided in the Key Resources Table. Membranes were blocked (SuperBlock Blocking Buffer) for one h at room temperature in the presence of RNase Inhibitor, subjected to IRDye 800CW Streptavidin (Li-COR) secondary detection reagent for one h at room temperature and images acquired on a Li-COR Odyssey CLx infrared imager using Image Studio version 3.1. Images were exported using Image Studio Lite version 5.2.

RNase H digestion

10ug of RNA was denatured at 98°C for 1 min and then annealed with a 10-fold molar excess of DNA oligonucleotide. After reaching room temperature, RNase H buffer (New England Biolabs) was added in addition to enzyme (New England Biolabs) or water. RNase H digestion was conducted for 15 min at 37°C. RNA was silica column purified after digestion.

Divalent cation nicking

1x T4 RNA ligase I buffer (New England Biolabs), containing magnesium, was added to RNA sample and RNA in buffer was heated at 70°C for the indicated duration.

HPLC

100ng-2ug of RNA was diluted in water and run on an Agilent 1100 HPLC in 1x TE pH 6 running buffer through a 4.6 × 300mm size-exclusion column with particle size of 5μm and pore size of 2000¾¾¾ heated to 35°C (Agilent). In some cases, 1x T4 RNA ligase buffer (New England Biolabs) was added to the sample prior to injection. In some cases, EDTA was added to the sample prior to injection to a final concentration of 50mM.

Quantification and statistical analysis

Significance is defined as the relative migration of circular RNA with standard RNA markers.

Data and code availability

  • •

    Unprocessed images have been deposited at Mendeley Data and are publicly available as of the date of publication. DOIs are listed in the key resources table.

  • •

    This paper does not report any original code.

  • •

    Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Acknowledgments

We thank Prof. Ling-ling Chen (SIBCB) and Prof. Sara Cherry (U. Penn) for comments. This work was supported by NIH 5T32AR050942-15 (B.T.A.) and NIH R35-CA209919 (H.Y.C.). H.Y.C. is an investigator of the Howard Hughes Medical Institute.

Author contributions

B.T.A. designed and performed experimental procedures, interpreted data, and wrote the manuscript. A.W. designed and performed experimental procedures, interpreted data, and wrote the manuscript. R.C. created DNA plasmids and interpreted data. D.G.A. interpreted data and wrote the manuscript. H.Y.C. supervised experimental design, interpreted data, and wrote the manuscript.

Declaration of interests

H.Y.C. and R.C. are named as inventors on patents related to circRNA held by Stanford University. D.G.A. and A.W. hold equity in Orna Therapeutics, and A.W. is an employee of Orna Therapeutics. B.T.A. is an employee of Eli Lilly and Company. R.C. is a consultant for Circ Bio and an employee of Cartography Biosciences. H.Y.C. is a member of the Molecular Cell Advisory Board, co-founder of Accent Therapeutics, Boundless Bio, Circ Bio, and Cartography Biosciences, and an advisor of 10x Genomics, Arsenal Biosciences, Chroma Medicine, and Spring Discovery.

Inclusion and diversity

While citing references scientifically relevant for this work, we also actively worked to promote gender balance in our reference list. The author list of this paper includes contributors from the location where the research was conducted who participated in the data collection, design, analysis, and/or interpretation of the work.

Supplemental information

References

    • Chen L.-L.

    The expanding regulatory mechanisms and cellular functions of circular RNAs.

    Nat. Rev. Mol. Cell Biol. 2020; 21 : 475-490
    • Chen Y.G.
    • Kim M.V.
    • Chen X.
    • Batista P.J.
    • Aoyama S.
    • Wilusz J.E.
    • Iwasaki A.
    • Chang H.Y.

    Sensing Self and Foreign Circular RNAs by Intron Identity.

    Mol. Cell. 2017; 67 : 228-238.e5
    • Chen Y.G.
    • Chen R.
    • Ahmad S.
    • Verma R.
    • Kasturi S.P.
    • Amaya L.
    • Broughton J.P.
    • Kim J.
    • Cadena C.
    • Pulendran B.
    • et al.

    N6-Methyladenosine Modification Controls Circular RNA Immunity.

    Mol. Cell. 2019; 76 : 96-109.e9
    • Jeck W.R.
    • Sharpless N.E.

    Detecting and characterizing circular RNAs.

    Nat. Biotechnol. 2014; 32 : 453-461
    • Kristensen L.S.
    • Andersen M.S.
    • Stagsted L.V.W.
    • Ebbesen K.K.
    • Hansen T.B.
    • Kjems J.

    The biogenesis, biology and characterization of circular RNAs.

    Nat. Rev. Genet. 2019; 20 : 675-691
    • Liu C.X.
    • Guo S.K.
    • Nan F.
    • Xu Y.F.
    • Yang L.
    • Chen L.L.

    RNA circles with minimized immunogenicity as potent PKR inhibitors.

    Mol. Cell. 2022; 82 : 420-434.e6
    • Memczak S.
    • Jens M.
    • Elefsinioti A.
    • Torti F.
    • Krueger J.
    • Rybak A.
    • Maier L.
    • Mackowiak S.D.
    • Gregersen L.H.
    • Munschauer M.
    • et al.

    Circular RNAs are a large class of animal RNAs with regulatory potency.

    Nature. 2013; 495 : 333-338
    • Salzman J.
    • Gawad C.
    • Wang P.L.
    • Lacayo N.
    • Brown P.O.

    Circular RNAs are the predominant transcript isoform from hundreds of human genes in diverse cell types.

    PLoS ONE. 2012; 7 : e30733
    • Wesselhoeft R.A.
    • Kowalski P.S.
    • Anderson D.G.

    Engineering circular RNA for potent and stable translation in eukaryotic cells.

    Nat. Commun. 2018; 9 : 2629
    • Wesselhoeft R.A.
    • Kowalski P.S.
    • Parker-Hale F.C.
    • Huang Y.
    • Bisaria N.
    • Anderson D.G.

    RNA Circularization Diminishes Immunogenicity and Can Extend Translation Duration In Vivo.

    Mol. Cell. 2019; 74 : 508-520.e4
    • Zhang Y.
    • Zhang X.O.
    • Chen T.
    • Xiang J.F.
    • Yin Q.F.
    • Xing Y.H.
    • Zhu S.
    • Yang L.
    • Chen L.L.

    Circular intronic long noncoding RNAs.

    Mol. Cell. 2013; 51 : 792-806
    • Zhang X.-O.
    • Wang H.-B.
    • Zhang Y.
    • Lu X.
    • Chen L.-L.
    • Yang L.

    Complementary sequence-mediated exon circularization.

    Cell. 2014; 159 : 134-147
    • Zhang Y.
    • Yang L.
    • Chen L.L.

    Characterization of Circular RNAs.

    Methods Mol. Biol. 2016; 1402 : 215-227
  • View Large Image
  • Download Hi-res image

Linked Article

  • RNA Circularization Diminishes Immunogenicity and Can Extend Translation Duration In Vivo

    Molecular Cell March 19, 2019

    • In Brief

      Wesselhoeft et al. find that exogenous circular RNAs are able to bypass RNA sensors, thereby avoiding antiviral defense induction upon cellular entry. They report that nanoformulated, synthetic protein-coding circRNA can be translated in mouse tissues, providing evidence for the potential of circRNA as a vector for therapeutic gene expression.

    • Full-Text
    • PDF
    Open Archive

stillerreacquink.blogspot.com

Source: https://www.cell.com/molecular-cell/fulltext/S1097-2765(22)00217-9

0 Response to "Continuous Perfusion of Mammalian Cells Embedded in Agarose Gel Threads Exp Cell Res"

Publicar un comentario

Iklan Atas Artikel

Iklan Tengah Artikel 1

Iklan Tengah Artikel 2

Iklan Bawah Artikel